Introduction:
Maintenance of normal pregnancy depends on the correct preparation of the endometrium during decidualization. The maternal part of the placenta cells and trophoblast cells, that secrete regulatory factors contributing to the implantation of the blastocyst and the formation of fetal-maternal surface, form complex interactions.(1) Invasive processes in trophoblast in the first trimester and cancer have common features.(2-4) However, trophoblast invasion is a strictly controlled physiological event, limited in time and localized in space (implantation window). Invasion process involves the degradation of components of the basement membrane and extracellular matrix and cell migration through the eroded tissue stroma. As with all types of invasive cells, trophoblast cells ability to penetrate into the uterine wall is facilitated by activity of matrix metalloproteinases (MMP).(2,5,6)
J Gross and C Lapier described MMPs for the first time in vertebrates in 1962 in enzyme activity study of tadpole tail during metamorphosis; 23 MMPs have been found in humans.(7,8)
MMPs are involved in folliculogenesis, ovulation, corpus luteum formation and regression, blastocyst implantation and placentation. MMPs play an important role in human reproduction, because in the early stages of embryogenesis the degradation and remodeling of extracellular matrix are key processes.
Phylogenetically MMPs activity is highest in embryogenesis, then after the birth progressively reduces and remains low throughout life.(9) Special role is assigned to MMP1, MMP2, MMP3 and MMP9 during trophoblast behavior regulating and blastocyst implantation.(10,11)
Currently, there is no evidence on the relationship of MMP20 gene expression, and it’s polymorphisms and in humans embryogenesis in the PubMed indexed literature.
MMP20 gene is locate on chromosome 11q22.2, contains 10 exons.(12,13) It is known that it encodes an enzyme that destroys amelogenin, the main protein component of tooth enamel matrix and thus plays an important role in the dental enamel formation and oral carcinogenesis.(12,14-17)
The aim of this study was to investigate the association of Val275Ala (rs1784423) and A320C (rs2245803) polymorphisms of MMP20 gene with pregnancy loss in the first trimester in women, and gene expression analysis in decidua and chorionic tissues.
Materials and Methods
Prior to inclusion in the study, all subjects underwent a standard diagnostic work-up. Women with the uterine abnormalities and polycystic ovary syndrome, previously diagnosed hypertension, diabetes, thyroid disease and autoimmune disorders, and infectious diseases during pregnancy were excluded from studied population. Women contacting with exogenous risk factors, such as alcohol, electromagnetic radiation, industrial noise, vibration, chemical pollutants were also excluded. All smokers also were excluded from studied population because there are data, that tobacco smoking is a factor that increases the risk of spontaneous abortion.(18) After approval by institutional review board, 132 women with spontaneous abortion in the first trimester and 144 women with normally progressing pregnancies and without any history of spontaneous or missed abortion were studied. The participants willingly signed the informed consent.
Samples of chorionic and decidual tissues were taken after surgical termination by curettage of normally progressing pregnancies in 5-9 week of gestation (n=12) and spontaneous abortion in 5-9 week of gestation (n=12). Villous samples from the control group were obtained from women undergoing elective abortion for social reasons. Samples were stored at -80°C in aliquots for RNA isolation, and thawed only once to avoid degradation.
Genomic DNA was isolated using phenol chloroform method from decidual and chorionic tissue. Polymorphism Val275Ala (rs1784423) and A320C (rs2245803) MMP20 gene were detected by allele-specific polymerase chain reaction method using SNP-express reaction kits (Lytech, Russia). The assay is based on carrying out the amplification reaction in pairs with the two allele-specific primers. The PCR products were analyzed by horizontal 3% agarose gel electrophoresis. Gel images were captured using GelDoc XR system (Bio-Rad, USA). Densitometry was performed using ImageJ (NIH, USA). The background was subtracted with the rolling ball radius of 50 pixels.
Total RNA from samples of decidua and chorionic tissue was extracted by the acid guanidinium thiocyanate phenol method.(19) After isolation, RNA was immediately treated with DNAse (Roche, Switzerland). The concentration of the purified total RNA samples was determined using spectrophotometer SmartSpec Plus (BioRad, USA) at 260 nm.
The RNA was reverse transcribed immediately after the RNA isolation and the DNAse treatment using the “RT kit” (Syntol, Russia) with the template denaturation step and the oligo (dT) primer. To carry out reverse transcription polymerase chain reaction reagents produced by Syntol (Russia) was used. The reaction mixture consisted of: 1 µl primer Random-6 (Syntol, Russia), 2 µg the total RNA, 10 µl H2O, deionized, free of nucleases. For thermal denaturation step - 70 ° C for 5 minutes. After primer annealing samples cooled on ice and the remaining reagents were added for reverse transcription, including: 10 µl 2,5 X reaction mixture, 1 µl reverse transcriptase MMLV-RT (50 U/ µl); 1 µl RNase inhibitor (5 U/ µl).
Probe without a reverse transcriptase served as negative control. Reverse transcription was performed for 50 min incubation at 42°C for 50 minutes, followed by duration of 92°C for 10 min. cDNA samples were stored at -20°C. The inactivation of the reverse transcriptase MMLV-RT was performed at 92°C for 8 minutes. The obtained cDNA was used for amplification.
MMP20 gene expression level was determined by real-time PCR on CFX96 (Bio-Rad, USA). Primers was purchased from Syntol (Russia). The forward and reverse primers and probes used sequence are presented in the Table 1.
The amplification reaction was conducted in two replicates for each sample. Cycling parameters were the following: 94°C for 10 min; 40 cycles: 60°C for 50 c, 94°C for 15 c. The reaction mixture (Syntol (Russia)) consisted of: 2,5 µl dNTPs (2,5 mM), 2,5 µl 10x PCR buffer, 2,5 µl MgCI2 (25 mM), 1,0 µl primer (10 pmol/ µl), 0,5 µl probe with a fluorescent label (10 pmol / µl), 0,5 µl Tag DNA-polymerase (5 U/ µl), deionized H2O to 22,0 µl and 3,0 µl cDNA sample.
Table 1: Sequence of PCR probes and primers |
Gene |
Sequence of PCR probes and primers |
MMP20 |
Forward 5'- AAGTCACCGGGAAGTTAGA -3'
Reverse 5'- CAGGGAAGAGGCGATAATTG -3'
Probe Fam- TCGCTGTGGAGTTCCTGATGTGGC-TAMRA |
GAPDH |
Forward 5'-AGGTCGGAGTCAACGGATTT-3'
Reverse 5'- ATCGCCCCACTTGATTTTGG-3'
Probe Fam- GGCGCCTGGTCACCAGGGCT-BHQ1 |
Hardy-Weinberg equilibrium analyses were performed using Hardy-Weinberg equilibrium calculator in www.oege.org/software/Hardy-Weinberg.(20) Differences in distribution of allele variants between studied groups were assessed by Χ2-analyses. P-value <0.05 was considered statistically significant. To evaluate pregnancy loss risk we calculated odd ratios (OR). OR was indicated with 95% confidence interval (CI).
Statistical analysis of gene expression data in tissues was performed by Χ2-ΔΔCt method by Livak K and Schmittgen T.(21)
Results
Frequencies of genotypes and alleles for polymorphisms Val275Ala (rs1784423) and the A320C (rs2245803) of the gene MMP20 are shown in Table 2.
The distributions of all genotypes in each group were in Hardy-Weinberg equilibrium. Heterozygotes dominated in women with polymorphism Val275Ala (rs1784423). The frequency of allele 275Ala among women with miscarriage was 50%, the same value in the control group. The nature of the frequency distribution of genotypes and alleles for the polymorphism Val275Ala MMP20 gene in the comparison group equal to the control group.
Differences between the two groups of women for polymorphism A320C (rs2245803) of the gene MMP20 was not detected.
Table 2: The frequency of alleles and genotypes (absolute value, %) for polymorphic variants of MMP20 gene in the blood cells of women with miscarriage |
Genotype |
Control |
Miscarriage |
OR (95% CI) |
Χ2 (p)* |
Val275Ala (rs1784423) |
Val/Val |
33 (22.9) |
33 (25.0) |
1.12 (0.64 – 1.95) |
0.23 (0.89) |
Val / Ala |
77 (53.5) |
67 (50.8) |
0.90 (0.56 – 1.44) |
Ala / Ala |
34 (23.6) |
32 (24.2) |
1.04 (0.60 – 1.80) |
275Ala allele |
0.503 |
0.496 |
0.97 (0.70 – 1.36) |
0.03 (0.86) |
A320C (rs2245803) |
AA |
16 (11.2) |
19 (14.8) |
1.38 (0.68 – 2.82) |
1.37 (0.5) |
AC |
59 (41.3) |
56 (43.8) |
1.11 (0.68 – 1.79) |
CC |
68 (47.6) |
53 (41.4) |
0.78 (0.48 – 1.26) |
320C allele |
0.682 |
0.633 |
0.80 (0.56 – 1.15) |
1.44 (0.23) |
*Χ2 – comparison of frequencies of genotypes and alleles of the control |
Gene transcription is different in the embryonic and maternal origin tissues as in normal pregnancy and in early pregnancy loss. Detected mRNA level of MMP20 was significantly higher in decidual tissue compared to chorionic tissue (p = 0,0037, p = 0,014 respectively). The data is presented in Figure 1 and Table 3. From Table 3 it can be seen, that the expression level of the gene MMP20 in tissues of maternal origin in studied and control groups was above the level of MMP20 gene expression in chorionic tissue. The MMP20 gene expression pattern in chorionic tissue was equal to control (p = 0,79) (Table 4). There is a tendency to MMP20 gene expression decrease in decidua tissue in miscarriage. However, there was no statistically significant differences in comparison with control (p = 0,26).
 |
Figure 1- MMP20 gene expression level in the cells of chorionic and decidual tissues regarding GAPDH gene expression at normally progressing pregnancy (A) and pregnancy loss (B) |
Table 3: Rate of change of the expression level (2-ΔΔCt) of gene MMP20 in decidual tissue relative to the chorionic tissue |
Gene |
Normally progressing pregnancy |
Miscarriage pregnancy loss |
MMP20 |
123.6 |
54.6 |
Table 4: Rate of change of the expression level (2-ΔΔCt) of gene MMP20 in miscarriage, relative to physiological pregnancy |
Gene |
Decidual tissue |
Chorionic tissue |
MMP20 |
0.37 |
0.83 |
Discussion
Normally developing pregnancy is accompanied by alteration of tissues in the mother's body. The embryo is characterized by more pronounced changes in structure, including not only cell division that associated with the formation of tissues and organs anlage, but also cell migration, extra embryonic tissues invasion into the maternal tissues and placentation. All these processes require tissue intercellular space and cell structure reorganization, which in turn is caused by proteolytic enzymes functioning, including metalloproteinases and their inhibitors. (22,23)
Changes in MMP genes expression on mRNA and functionally active protein levels lead to disruption of trophoblast invasion process. Many early pregnancy loss cases are accompanied by anatomical defects of placenta, such as thin and fragmented trophoblast, violation of cytotrophoblast invasion into the uterus and incomplete closure of the spiral arteries, leading to premature excessive blood supply to the developing placenta.(24,25) Excessive blood filling in intervillous space causes a direct mechanical effect in the villous tissue, and oxygen-dependent damage in the trophoblast followed by apoptosis activation.(26,27) As a result, disruption in syncytiotrophoblast functioning and placental abruption becomes possible. In addition, the invasive potential of decidual cells may explain the violation of a current pregnancy.(28)
Regulation of MMP activity can be crucial for successful implantation and placentation. According to numerous studies using animal models, many MMP subtypes expressed not only in invading trophoblast cells, but also in the endometrial stromal cells and natural killer (NK) in the maternal uterus tissue.(29) Anacker J et al have shown that all known human MMPs except MMP20 were expressed at the mRNA level in human decidua during pregnancy.(5)
The expression of MMP8 and MMP13 during pregnancy is shown.(5) MMP2 and MMP9 play special role in trophoblast behavior regulation.(11) MMP1 and MMP3 are also detected in the extracellular trophoblast, which contribute to blastocyst implantation.(10,11) MMP27 and MMP28 are expressed predominantly in trophoblast cells.(5) Then it was shown that MMP25 and MMP20 are expressed in invading extravillous cytotrophoblast cells.(29)
Matrix metalloproteinases gene polymorphisms increase early pregnancy loss risk.(11) The frequency of polymorphisms MMP2 -735 C/T and MMP9 -1562 C/C significantly increased in women with idiopathic recurrent pregnancy loss.(10,11) We have shown that the A-8202G MMP9 polymorphism is associated with an increased risk of miscarriage in the first trimester.(30)
Cohen M et al investigated the level of mRNA MMP gene and protein expression during pregnancy and suggested that decidual stromal cells have higher expression levels of MMP than trophoblast cells, and decidual tissue susceptibility to invasion is probably increased in the presence of cytotrophoblast cells. In contrast, decidual cells don’t impact the invasive properties of cytotrophoblast.(28)
Our investigation have not detected association of gene polymorphisms MMP20 Val275Ala (rs1784423) and A320C (rs2245803) with miscarriage in the first trimester. Also in our findings we have shown the tendency of reducing the MMP20 gene mRNA level in decidua tissue in spontaneous abortion, although the data are no statistically significant differences.
Conclusion
We have shown for the first time that MMP20 is expressed in embryonic tissues and decidua with significantly higher expression level in decidual tissue compared with chorionic. Our data revealed the tissue-specific MMP20 expression in normal pregnancy and spontaneous abortion. It points the role of MMP during pregnancy This highlights the relevance of further studies.
Acknowledgement
This study was supported by the federal assignment No. 6.98.2014/K from Russian Ministry of Science and Education.
Conflict of Interest: None.
References
- Pereza N, Volk M, Zrakic N, et al. Genetic variation in tissue inhibitors of metalloproteinases as a risk factor for idiopathic recurrent spontaneous abortion. Fertil Steril. 2013;99(7):1923-1929.
- Halasz M, Polgar B, Berta G, et al. Progesterone-induced blocking factor differentially regulates trophoblast and tumor invasion by altering matrix metalloproteinase activity. Cell Mol Life Sci. 2013;70(23):4617-4630.
- Borbely A, Sandri S, Fernandes I, et al. The term basal plate of the human placenta as a source of functional extravillous trophoblast cells. Reprod Biol Endocrinol. 2014;12(7):1–12.
- Renaud S, Kubota K, Rumi M, Soares M. The FOS Transcription Factor Family Differentially Controls Trophoblast Migration and Invasion. The Journal of Biological Chemistry. 2014;289: 5025-5039.
- Anacker J, Segerer S, Hagemann C, et al. Human decidua and invasive trophoblasts are rich sources of nearly all human matrix metalloproteinases. Mol Hum Reprod. 2011;17(10):637-52.
- Estella C, Herrer I, Atkinson S, et al. Inhibition of histone deacetylase activity in human endometrial stromal cells promotes extracellular matrix remodelling and limits embryo invasion. PLoS One. 2012;7(1):e30508.
- Koizumi M, Momoeda M, Hiroi H, et al. Inhibition of proteases involved in embryo implantation by cholesterol sulfate. Hum Reprod. 2010;25(1):192-197.
- Kalinkin M, Soloviev V, Shinkarenko T, et al. Matrix metalloproteinases and their role in the pathogenesis of cardiovascular diseases. Herald of TSU. Series: Biology and Ecology. 2011;22(12):64-76.
- Sbardella D, Fasciglione G, Gioia M, et al. Human matrix metalloproteinases: An ubiquitarian class of enzymes involved in several pathological processes. Molecular Aspects of Medicine. 2012;33:119–208.
- Palei A, Sandrim V, Amaral L, et al. Effects of matrix metalloproteinase MMP-2 polymorphisms on responsiveness to antihypertensive therapy of women with hypertensive disorders of pregnancy. Basic Clin Pharmacol Toxicol. 2012;111(4):262-267.
- Pereza N, Ostojic S, Volk M, et al. Matrix metalloproteinases 1, 2, 3 and 9 functional single-nucleotide polymorphisms in idiopathic recurrent spontaneous abortion. Reprod Biomed Online. 2012; 24(5):567-575.
- Llano E, Pendas A, Knauper V, et al. Identification and structural and functional characterization of human enamelysin (MMP-20). Biochemistry. 1997;36:15101-15108.
- Moradian-Oldak J. Protein- mediated enamel mineralization. Front Biosci. 2012;17:1996–2023.
- Küchler E, Menezes R, Callahan N, et al. MMP1 and MMP20 contribute to tooth agenesis in humans. Arch Oral Biol. 2011;56(5):506-511.
- Yang, X, Sun Z, Ma R, et al. Amelogenin "nanorods" formation during proteolysis by Mmp-20. J Struct Biol. 2011;176(2):220-228.
- Khan, F, Li W, Habelitz S. Biophysical characterization of synthetic amelogenin C-terminal peptides. Eur J Oral Sci. 2012;120(2):113-122.
- Khan F, Liu H, Reyes A, et al. The proteolytic processing of amelogenin by enamel matrix metalloproteinase (MMP-20) is controlled by mineral ions. Biochim Biophys Acta. 2013;1830(3):2600-2607.
- Ness R, Grisso J, Hirschinger N, et al. Cocaine and tobacco use and the risk of spontaneous abortion. The New England Journal of Medicine. 1999;340(5):333-339.
- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry. 1987;162(1):156-159.
- Rodriguez S, Gaunt T. Day I. Hardy-Weinberg Equilibrium Testing of Biological Ascertainment for Mendelian Randomization Studies. American Journal of Epidemiology Advance Access. 2009;169(4):505-514.
- Livak K, Schmittgen T. Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 2-ΔΔCT Method. Methods. 2001;25:402–408.
- Bosc D, Goueli B, Janknecht R. HER2/Neu-mediated activation of the ETS transcription factor ER81 and its target gene MMP-1. Oncogene. 2001;20(43):6215-6224.
- Shibahara H, Suzuki T, Kikuchi K., et al. Serum matrix metalloproteinase and tissue inhibitor of metalloproteinase concentrations in infertile women achieved pregnancy following IVF-ET. Am J Reprod Immunol. 2005;54(4):186-192.
- Hustin J, Jauniaux E, Schaaps J. Histological study of the materno–embryonic interface in spontaneous abortion. Placenta. 1990;11:477–486.
- Jauniaux E, Zaidi J, Jurkovic D, et al. Comparison of color Doppler features and pathologic findings in complicated early pregnancy. Hum. Reprod. 1994;9:243–247.
- Kokawa K, Shikone T, Nakano R. Apoptosis in human chorionic villi and decidua during normal embryonic development and spontaneous abortion in the first trimester. Placenta. 1998;19(1): 21-26.
- Jauniaux E, Poston L, Burton G. Placental-related diseases of pregnancy: involvement of oxidative stress and implications in human evolution. Hum. Reprod. 2006;12:747-755.
- Cohen M, Wuillemin C, Irion O, Bischof P. Role of decidua in trophoblastic invasion. Neuro Endocrinol Lett. 2010;31:193–197.
- Zhu J, Pang Z, Yu Y. Regulation of trophoblast invasion: the role of matrix metalloproteinases?. Rev Obstet Gynecol. 2012;5(3-4):e137–e143.
- Mashkina E, Kovalenko K, Marakhovskaya T, et al. Study of association of polymorphic markers of matrix metalloproteinases genes with reproductive losses in the first trimester of pregnancy. Russian J of Genetics. 2016;58(8).
|
