Introduction:
The signs of shigellosis, caused by Shigella spp., include diarrhea and/or dysentery with frequent mucosal, bloody stools as well as abdominal cramps. Shigellosis is a major public health concern related to diarrhea-related morbidity and mortality, especially in children younger than five years of age (1, 2) . There are 164.7 million cases of Shigella spp. infection and 1.1 million deaths per year, especially in developing countries (3, 4). Over the past few decades, the indiscriminate use of drugs has led to an increase of bacterial resistance to the most widely used and inexpensive antibiotics (5). For example, many bacterial strains are resistant to Nalidixic acid (NAL), a first-line therapeutic choice in many countries, such as Iran (6-9). As an alternative, Ciprofloxacin (CIP) has been suggested by the World Health Organization as the first-line choice for patients with bloody diarrhea (10, 11).
Quinolone resistance is mainly mediated by substitution mutations in the QRDRs region of gyrA and gyrB and topoisomerase IV (parC and parE) (12, 13) . Commonly, the Shigella strains developed high fluoroquinolone (FQ) resistance due to substitution in the QRDRs of gyrA (Ser83 and Asp87) and parC (Ser80 and Glu84)(14). DNA sequencing is the gold-standard method for detecting genetic variants and identifying the order of the DNA molecule (15). However, it is relatively expensive when examining a large sample pool. Small genetic variation in polymerase chain reaction (PCR) amplicons can be detected using real-time, PCR-based, high-resolution melt (HRM) analysis (16). This method is very sensitive and specific and has been employed in single nucleotide polymorphism (SNP) scanning (17).
In HRM analysis, a DNA-intercalating dye reacts with double-stranded DNA and, as a result of this reaction, emits a ?uorescent signal (18, 19). After conducting PCR and exposing the DNA samples to a temperature gradient, in HRM method each DNA sample demonstrates a unique melting profile(19, 20). Isolates analysis based on their sequence, length, guanine-cytosine content (GC ) content, and different melting temperatures (Tms) (21). In many studies, HRM analyses were used to detect mutations in many microorganisms, including in, Francisella tularensis (22),Yersinia pestis (22), Mycobacterium tuberculosis (23), Bacillus anthracis (22), Salmonella Typhi (19), and Salmonella Paratyphi A(19), as it is cost-effective, rapid, reliable, sensitive, and specific. For this current study, we aimed to identify the most common gyrA and parC mutations in Shigella spp., with the high-resolution melting method in pediatric patients in Iran.
Materials and Methods:
Bacterial Isolates
This study included Shigella spp (sonnei and flexneri); these isolates were recovered from a clinical pediatric patient between the years 2015 and 2017. The isolates were identified through serotyping and conventional biochemical and molecular methods. The template DNA for PCR was extracted through the boiling water-bath method. The DNA concentration of the samples was estimated by using a Nano Drop ND-100 (NanoDrop Technologies, Wilmington, DE). Escherichia coli ATCC (35218), Pseudomonas aeruginosa ATCC (27853), and Escherichia coli ATCC (25922) were used as a quality control. For the routine laboratory measurement of NAL and CIP minimum inhibitory concentration (MIC), broth microdilution was used as a reference method (24).
Development of Real-Time PCR Assay with HRM Analysis
PCR amplification of the gyrA and parC genes with specific primers and the sequencing of the QRDRs of the gyrA and parC genes were carried out.
Two primer pairs amplified a partial sequence of gyrA (F5TACACCGGTCAACATTGAGG 3´ and F5´TTAATGATTGCCGCCGTCGG R3´) and parC (F5 GTCTGAACTGGGCCTGAATGC 3 and R5´AGCAGCTCGGAATATTTCGACAA 3´) (25). The amplification was carried out in a DNA thermal cycler as follows: (I) 30 cycles consisting of 60 s at 91°C, 60 s at 64°C, and 120 s at 74°C and (II) a final extension step of 10 min at 74°C. PCR products were purified using a PCR-purification kit (Qiagen, USA), and all purified PCR products were directly sequenced using an ABI3100 genetic analyzer (CEQ 2000 XL DNA analysis system, Beckman Coulter). The obtained gyrA and parC nucleotide sequences were aligned with the EcoliK72 sequence.
For the HRM test, gyrA and parC fragments were amplified. The Bioneer Company (Bioneer,Taejun, South Korea), synthesized the DNA primer oligonucleotide gyrA F5' TGGTGACGTAATCGGTAAATACCA 3', gyrA R GAATGGCTGCGCCATACG, parC F5' GACGTACTGGGTAAATACCATCCG3', and parC R5' TCAACCAGCGGATAACGGTAA 3' (26). First, primer optimization was performed and then real-time PCR amplifications were carried out. PCR reactions were prepared by mixing each reaction into a total volume of 20 µl, which contained 4 µl of 5x HOT FIREPol DNA polymerase (Evergreen HRM Mix, Solis BioDyn, Estonia), 50 ng of sample DNA template, 5 PM of each primer, and 15 H2O. Thermal cycling conditions for the PCR protocol consisted of an initial denaturation of each primer at 95°C for 15 min, followed by 35 cycles at 95°C for 15 s, annealing the primers at 58°C/20 s, and extension (72°C/30 s). After PCR completion, amplification was continued by a Tms program ranging from 70–90°C with 0.1°C increases in temperature per step and corresponding pauses to quantify the fluorescence change of the sample. HRM analysis was performed using the RotorGene Q software.
Results:
Detection of QRDR Mutations
The HRM analyses of antibiotic susceptibilities were conducted following Clinical Laboratory Standards Institute methods(24). The test was performed on 5 sequenced NAL-susceptible clinical isolates of Shigelli flexneri and Shigella soonei and 36 unsequenced resistant isolates include: 5 CIP resistant and 30 NAL resistant isolates. The NAL-susceptible strains were used to establish a cutoff value that showed the presence of a gyrA and parC mutations and, thus, resistance to NAL or CIP. Of 40 isolates, 5 isolates were NAL-susceptible with a MIC = 2. The MIC for 5 of the NAL- and CIP-resistant isolates was = 256, and the MIC in 30 NAL-resistant isolates was = 8.
In our study, results of in-vitro susceptibility testing, HRM method and sequencing was compared. The first Tm determined in our study was the cutoff value for wild-type isolates (range: 83.50–83.80°C).
Melt curves for mutation groups in gyrA and mutation in parC isolates of identified sequence are presented in Tables 1 and 2 (experiments were repeated three times). Presence or absence of mutations in the gyrA and parC genes in Shigella spp., obtained with Tms of almost 83–85°C and revealed the susceptibility. In the HRM method, wild-type isolates presented dissimilar melt curves in comparison with mutant strains, showing mutations at codons 83 (S83L) and 87 (D87G or D87Y) in gyrA and 83 (S83I) in parC, which were confirmed by sequencing. In all NAL-resistant isolates that had one mutation in gyrA’s codons S83L or D87Y, the Tm was lower than in the wild-type strains (below the cutoff value). Shigella isolates with gyrA mutations, typically at both codon 83 and 87, constantly had one feature: Tms higher than the cutoff value of 83.9–84.1°C as compared to isolates without gyrA mutation (Table 1).
| Table 1: Nucleotide and amino acid sequences, Melting temperatures, and antibiotic susceptibilities for NAL-susceptible and NAL-resistant shigella spp. isolates. |
Classification and strains |
MIC ( g/ml)a |
Tm (ºC) |
Range |
Nucleotide and amino acid change |
NAL MIC (Ag/mL) |
CIP MIC (Ag/mL) |
gyrA position |
83 (TCG [Ser]) |
87 (GAC [Asp]) |
Group A (NAL Resistance strains) |
SS 1 |
256 |
1 |
82.95 |
82.90-83.01 |
(TCG [Ser]) |
(TAC [Tyr]) |
SS 2 |
256 |
0.5 |
82.99 |
82.94-83.04 |
(TCG [Ser]) |
(TAC [Tyr]) |
Group B (NAL Resistance strains) |
SS 3 |
32 |
0.125 |
83.25 |
83.20-83.30 |
(TTG [Leu]) |
(GAC [Asp]) |
SS 4 |
32 |
0.016 |
83.35 |
83.30-83.41 |
(TTG [Leu]) |
(GAC [Asp]) |
SS 5 |
8 |
0.5 |
83.20 |
83.17-83.23 |
(TTG [Leu]) |
(GAC [Asp]) |
Group C (NAL and CIP) susceptible strains) |
SF6 |
0.012 |
0.008 |
83.58 |
83.54-83.62 |
(TCG [Ser]) |
(GAC [Asp]) |
SF7 |
0.008 |
0.012 |
83.55 |
83.50-83.60 |
(TCG [Ser]) |
(GAC [Asp]) |
SF8 |
0.012 |
0.008 |
83.59 |
83.52-83.68 |
(TCG [Ser]) |
(GAC [Asp]) |
Group D ( NAL and CIP resistant strains) |
SS 9 |
=256 |
=256 |
84.01 |
83.97-84.04 |
(TTG [Leu]) |
(GGC [Gly]) |
SS10 |
=256 |
=256 |
84.02 |
84.96-84.06 |
(TTG [Leu]) |
(GGC [Gly]) |
SS11 |
=256 |
=256 |
83.87 |
83.81-83.94 |
(TTG [Leu]) |
(GGC [Gly]) |
| CIP = ciprofloxacin NAL= Nalidoxic acid; SF: Shigella flexneri; SS: Shigella sonnei |
The Tm of the wild-type gyrA allele was 83.5–83.8°C while that of the mutant strains (S83L and D87G) were at 83.9–84.2°C. In the parC gene, the Tm for the wild-type allele was at 85.5–85.8°C, and the mutant-type allele’s Tm was at 85.30–85.50°C (100% melted under 85.50°C). Differences in the Tms were high in the parC gene and isolates with a parC mutation at codon 80 had lower Tm in comparison to wild-type strains (Table 2). Interestingly, Shigella strains with simultaneous mutations in gyrA (S83L or D87Y) and (D87G) as well as one mutation in parC showed resistance to CIP with MIC [greater than >8]. Therefore, isolates with Tm higher than 83.8°C in gyrA and a Tm between 85.30-85.50°C in parC were detected as a CIP- and NAL-resistant isolates with an MIC > 256. Isolates used in our study as a control in HRM method, were sequenced and registered in the NCBI database by accession numbers MF039632.1, MF139048.1, MF139047.1, MF139043.1, MF139042.1, MF139045.1, MF139046.1, MF139044.1, MF039631.1.
| Table 2: Melting temperatures, nucleotide and amino acid sequences, and antibiotic susceptibilities for NAL-susceptible and NAL- resistant shigella spp. isolates |
Classification and strain |
MIC ( g/ml)a |
|
|
Nucleotide and amino acid change |
NAL MIC (Ag/mL) |
CIP MIC (Ag/mL) |
Tm (ºC) |
Range |
parC position |
80(AGC [Ser]) |
84(GAA[Glu]) |
Group A( CIP and NAL susceptible strains) |
SF6 |
0.012 |
0.008 |
85.80 |
85.75-85.85 |
AGC [Ser]) |
GAA[Glu]) |
SF7 |
0.008 |
0.012 |
85.67 |
85.62-85.71 |
AGC [Ser]) |
GAA[Glu] |
SF8 |
0.012 |
0.008 |
85.58 |
85.58-85.81 |
AGC [Ser]) |
GAA[Glu] |
Group C (NAL and CIP resistant strains) |
SS9 |
=256 |
=256 |
85.27 |
85.22-85.34 |
ATC [Ile] |
GAA[Glu] |
SS10 |
=256 |
=256 |
85.32 |
85.29-85.35 |
ATC [Ile] |
GAA[Glu] |
SS11 |
=256 |
=256 |
85.45 |
85.40-85.49 |
ATC [Ile] |
GAA[Glu] |
| SF: Shigella flexneri; SS: Shigella sonnei |
Discussion:
The present study showed FQ resistance and genomic profiles of clinically related Shigella isolates circulating during a 2-year period from 2015 to 2017 in Tehran Province of Iran. High-level FQ resistance appears to be due to chromosomal point mutations in the QRDRs of gyrA and gyrB (DNA gyrase-a type II DNA topoisomerase) and parC and parE (DNA topoisomerases) as well as from changes in the expression of active efflux pumps (27, 28). Point mutations at codons Ser83 and Asp87 in the gyrA gene andSer80 and Glu84 in the parC geneare the most common in the FQ-resistant Shigella and Enterobacteriaceae (29, 30). In previous studies, several methods have been used to identify the mechanisms of FQ resistance (31). In this research, results of in-vitro susceptibility testing (CIP- and NAL-susceptibility), HRM method and sequencing was compared.
In a study by Slinger et al. (21), CIP-resistant isolates were not detected, and there were no reports of Tm in isolates with double mutations at codons 83 and 87 in the gyrA region. Also in the study by Slinger et al., the survey about mutation in parC gene in isolates was not identified. In our study, isolates with simultaneous mutations at codon 83 (Tm = 82.9–83.1°C, 83.1–83.5°C) and/or 87 (Tm = 83.9–84.1°C) gyrA and with mutations at codon 80 parC (Tm = 85.30–85.50°C) were 100% resistant to CIP and NAL. Consistent our study, Yang et al. declared that higher CIP MIC is associated with two or more point mutations in QRDR of gyrA and parC (32). Also, a study by Divya et al., (33) reported that a high level of resistance to CIP (MICs of 24 and 12 µg/ml) was related to mutations in gyrA at position 87 with a substitution at position 80 of parC. In agreement with Lee et al., there was a 100% concordance between specificity of the HRM assays and DNA sequencing for all genes analyzed (23). In the current study, mutants shigella isolates with mutation in gyrA and parC excellently discriminated with different Tm. Our data are consistent with the previous reports by Slinger et al. (21), Ngoi et al. (19), and Wang (17). In our study, all FQ-resistant isolates (NA-resistant and 5 Cip-resistant strains) had at least one mutation in one target region (Ser83 and Asp87 in the gyrA gene). These findings fully agree with Slinger et al's study (21). In the study directed by Lee et al., (23) an HRM assay detected mutations within the gyrA gene in all of the isolates. These researchers have suggested the possibility of mutations in regions not covered by our assay (in two isolates) and active efflux pumps (in four strains) (34).
Mutation at codon83 in QRDR region of gyrA was dominant and more isolates that were NAL resistant associated with mutations in this region. Therefore, for detect isolates with resistant to NAL, this region considered significant. Isolates with presence of double mutation in QRDR region of gyrA somewhat indicated that resistant to CIP in clinical shigella isolates.
Qiang et al., (35) mentioned that the rapid mismatch PCR method was not able to identify the nature of the mutation, and it is not considered an alternative method for DNA sequence analysis. In a study conducted by Loveless et al., the simple probe method had limited reactivity to a short sequence within an amplicon, but in the HRM method, detection of sequence mutations did not require a sequence-specific, probe-based assay (36). It is true that the pyrosequencing method detects minor mutations very well, but, unlike the HRM method, it needs standard PCR amplification, a longer assay, and two separate instruments for sequencing (36, 37). Moreover, in the HRM method, a single instrument is needed for real-time PCR amplification and the production of melting profiles (38). In comparison between methods, HRM response time (running time and the following data analysis) is much shorter than the simple probe method’s response time(32, 39). Other rapid mutation detection methods, including denaturing high-performance liquid chromatography (DHPLC), gyrA mutation assay (GAMA), and real-time PCR, have been previously studied (32, 40, 41). In several studies, the restriction enzymes method was performed for detecting mutations in the QRDR, but this technique is time consuming compared to HRM (5-24 h) and has a high risk of contamination (6). Briefly, the superiority of the HRM method is that it requires only the general equipment available in many laboratories, can be completed in less than one hour, is simple (including one-step and a lower risk of contamination than the closed-tube technique), and its platform costs are low (31). Aside from these advantages and despite the fact that mutations in the QRDRs of gyrA and parC are recognized to be related to NAL and CIP resistance, some studies show that not all resistant isolates have mutations in these genes. Therefore, this study had one limitation: that there may be isolates with resistance to NAL but without any mutation in the QRDRs. Despite this, it can be concluded that HRM method can easily detect mutations in the QRDRs of gyrA and parC in CIP-resistant isolates.
Conclusion
To the best of our knowledge, we applied an HRM assay for rapid and simple gene scanning in the FQ-resistant Shigella isolates for the first time in the Iran. The HRM assays described here are potentially useful adjunct tests for the rapid detection of FQs resistance in Shigella spp. and could facilitate the timely diagnostic drug-resistance methods for patients with shigellosis.
Acknowledgment
We thank to the Children's Medical Center, Bahman, Shariati, Valiasr, Imam Khomeini, Mofid Hospitals in Tehran for referring isolates and Epidemiological and demographic data for use in this study.
Conflict of Interests
The authors declare that there are no con?ict of interests regarding the publication of this paper.
References
- Tambe AB, Nzefa LD, Nicoline NA. Childhood diarrhea determinants in sub-Saharan Africa: a cross sectional study of Tiko-Cameroon. Challenges. 2015;6(2):229-43.
- Ashkenazi S, Editor Shigella infections in children: new insights. Seminars in Pediatric Infectious Diseases. 2004: Elsevier.
- Bardhan P, Faruque A, Naheed A, Sack DA. Decreasing shigellosis-related deaths without Shigella spp.–specific interventions, Asia. Emerging Infectious Diseases. 2010;16(11):1718.
- Yaghoubi S, Ranjbar R, Dallal MMS, Fard SY, Shirazi MH, Mahmoudi M. Profiling of virulence-associated factors in Shigella species isolated from acute pediatric diarrheal samples in Tehran, Iran. Osong Public Health and Research Perspectives. 2017;8(3):220.
- Huddleston JR. Horizontal gene transfer in the human gastrointestinal tract: potential spread of antibiotic resistance genes. Infect Drug Resist. 2014;7:167-76.
- Ranjbar R, Behnood V, Memariani H, Najafi A, Moghbeli M, Mammina C. Molecular characterisation of quinolone-resistant Shigella strains isolated in Tehran, Iran. Journal of Global Antimicrobial Resistance. 2016;5:26-30.
- Saeidi Y, Pournajaf A, Gholami M, Hasannejad-Bibalan M, Yaghoubi S, Khodabandeh M, et al. Determination of Helicobacter pylori virulence-associated genes in duodenal ulcer and gastric biopsies. Medical Journal of the Islamic Republic of Iran. 2017;31:95.
- Pournajaf A, Razavi S, Irajian G, Ardebili A, Erfani Y, Solgi S, et al. Integron types, antimicrobial resistance genes, virulence gene profile, alginate production and biofilm formation in Iranian cystic fibrosis Pseudomonas aeruginosa isolates. Infez Med. 2018;26(3):226-36.
- Pournajaf A, Rajabnia R, Razavi S, Solgi S, Ardebili A, Yaghoubi S, et al. Molecular characterization of carbapenem-resistant Acinetobacter baumannii isolated from pediatric burns patients in an Iranian hospital. Tropical Journal of Pharmaceutical Research. 2018;17(1):135-41.
- Cheasty T, Day M, Threlfall E. Increasing incidence of resistance to nalidixic acid in shigellas from humans in England and Wales: implications for therapy. Clin Microbiol Infect. 2004;10(11):1033-5.
- WHO. Guidelines for the control of shigellosis, including epidemics due to Shigella dysenteriae type 1. WHO, Geneva. 2005.
- Bébéar CM, Renaudin H, Charron A, Bové JM, Bébéar C, Renaudin J. Alterations in topoisomerase IV and DNA gyrase in quinolone-resistant mutants of Mycoplasma hominis obtained in vitro. Antimicrob Agents Chemother. 1998;42(9):2304-11.
- Yaghoubi S, Ranjbar R, Soltan Dallal MM, Shirazi MH, Sharifi-Yazdi MK. Frequency of mutations in quinolone resistance-determining regions and plasmid-mediated quinolone resistance in Shigella isolates recovered from pediatric patients in Tehran, Iran: An Overlooked Problem. Microbial Drug Resistance. 2018;24(6):699-706.
- Azmi IJ, Khajanchi BK, Akter F, Hasan TN, Shahnaij M, Akter M, et al. Fluoroquinolone resistance mechanisms of Shigella flexneri isolated in Bangladesh. PLoS One. 2014;9(7):e102533.
- Katsanis SH, Katsanis N. Molecular genetic testing and the future of clinical genomics. Nat Rev Genet. 2013;14(6):415-26.
- Twist GP, Gaedigk R, Leeder JS, Gaedigk A. High-resolution melt analysis to detect sequence variations in highly homologous gene regions: application to CYP2B6. Pharmacogenomics. 2013;14(8):913-22.
- Wang F, Shen H, Guan M, Wang Y, Feng Y, Weng X, et al. High-resolution melting facilitates mutation screening of rpsL gene associated with streptomycin resistance in Mycobacterium tuberculosis. Microbiol Res. 2011;166(2):121-8.
- Howell WM, Jobs M, Brookes AJ. iFRET: an improved fluorescence system for DNA-melting analysis. Genome Res. 2002;12(9):1401-7.
- Ngoi ST, Thong KL. High resolution melting analysis for rapid mutation screening in gyrase and topoisomerase IV genes in quinolone-resistant Salmonella enterica. BioMed Research International. 2014;2014.
- Winder L, Phillips C, Richards N, Ochoa-Corona F, Hardwick S, Vink CJ, et al. Evaluation of DNA melting analysis as a tool for species identification. Methods in Ecology and Evolution. 2011;2(3):312-20.
- Slinger R, Bellfoy D, Desjardins M, Chan F. High-resolution melting assay for the detection of gyrA mutations causing quinolone resistance in Salmonella enterica serovars Typhi and Paratyphi. Diagn Microbiol Infect Dis. 2007;57(4):455-8.
- Loveless BM, Yermakova A, Christensen DR, Kondig JP, Heine HS, Wasieloski LP, et al. Identification of ciprofloxacin resistance by SimpleProbe™, high resolution melt and pyrosequencingTM nucleic acid analysis in biothreat agents: Bacillus anthracis, Yersinia pestis and Francisella tularensis. Mol Cell Probes. 2010;24(3):154-60.
- Lee AS, Ong DC, Wong JC, Siu GK, Yam W-C. High-resolution melting analysis for the rapid detection of fluoroquinolone and streptomycin resistance in Mycobacterium tuberculosis. PLoS One. 2012;7(2):e31934.
- CLSI. M100-S25 performance standards for antimicrobial susceptibility testing; Twenty-fifth informational supplement; 2015.
- Dutta S, Kawamura Y, Ezaki T, Nair GB, Iida K-I, Yoshida S-I. Alteration in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in quinolone-resistant Shigella dysenteriae serotype 1 clinical isolates from Kolkata, India. Antimicrob Agents Chemother. 2005;49(4):1660-1.
- Kim J, Jeon S, Kim H, Park M, Kim S, Kim S. Multiplex Real-Time Polymerase Chain Reaction-Based Method for the Rapid Detection of gyrA and parC Mutations in Quinolone-Resistant Escherichia coli and Shigella spp. Osong Public Health and Research Perspectives. 2012;3(2):113-7.
- Johnning A, Kristiansson E, Fick J, Weijdegård B, Larsson D. Resistance mutations in gyrA and parC are common in Escherichia communities of both fluoroquinolone-polluted and uncontaminated aquatic environments. Frontiers in Microbiology. 2015;6:1355.
- Kim JY, Kim SH, Jeon SM, Park MS, Rhie HG, Lee BK. Resistance to fluoroquinolones by the combination of target site mutations and enhanced expression of genes for efflux pumps in Shigella flexneri and Shigella sonnei strains isolated in Korea. Clin Microbiol Infect. 2008;14(8):760-5.
- Qin T, Bi R, Fan W, Kang H, Ma P, Gu B. Novel mutations in quinolone resistance-determining regions of gyrA, gyrB, parC and parE in Shigella flexneri clinical isolates from eastern Chinese populations between 2001 and 2011. Eur J Clin Microbiol Infect Dis. 2016;35(12):2037-45.
- Al-Marzooq F, Mohd Yusof MY, Tay ST. Molecular analysis of ciprofloxacin resistance mechanisms in Malaysian ESBL-producing Klebsiella pneumoniae isolates and development of mismatch amplification mutation assays (MAMA) for rapid detection of gyrA and parC mutations. BioMed Research International. 2014;2014.
- Wong YP, Chua KH, Thong KL. One-step species-specific high resolution melting analysis for nosocomial bacteria detection. J Microbiol Methods. 2014;107:133-7.
- Eaves DJ, Liebana E, Woodward MJ, Piddock LJ. Detection of gyrA mutations in quinolone-resistant Salmonella enterica by denaturing high-performance liquid chromatography. J Clin Microbiol. 2002;40(11):4121-5.
- Adzitey F, Huda N, Ali GRR. Molecular techniques for detecting and typing of bacteria, advantages and application to foodborne pathogens isolated from ducks. 3 Biotech. 2013;3(2):97-107.
- Hisham PM, Shabina M, Remadevi S, Philomina B. Comparative analysis of detection methods of Extended Spectrum Beta Lactamases in Gram Negative clinical isolates with special reference to their Genotypic Expression. Journal of International Medicine and Dentistry. 2016;3(1):34-41.
- Qiang YZ, Qin T, Fu W, Cheng WP, Li YS, Yi G. Use of a rapid mismatch PCR method to detect gyrA and parC mutations in ciprofloxacin-resistant clinical isolates of Escherichia coli. J Antimicrob Chemother. 2002;49(3):549-52.
- Loveless BM, Yermakova A, Christensen DR, Kondig JP, Heine III HS, Wasieloski LP, et al. Identification of Ciprofloxacin Resistance by SimpleProbe (trademark), High Resolution Melt and Pyrosequencing (trademark) Nucleic Acid Analysis in Biothreat Agents: Bacillus anthracis, Yersinia pestis and Francisella tularensis. DTIC Document, 2010.
- Wang C, Mitsuya Y, Gharizadeh B, Ronaghi M, Shafer RW. Characterization of mutation spectra with ultra-deep pyrosequencing: application to HIV-1 drug resistance. Genome Res. 2007;17(8):1195-201.
- Tong SY, Giffard PM. Microbiological applications of high-resolution melting analysis. J Clin Microbiol. 2012;50(11):3418-21.
- Garritano S, Gemignani F, Voegele C, Nguyen-Dumont T, Le Calvez-Kelm F, De Silva D, et al. Determining the effectiveness of High Resolution Melting analysis for SNP genotyping and mutation scanning at the TP53 locus. BMC Genetics. 2009;10(1):5.
- Colasuonno P, Incerti O, Lozito ML, Simeone R, Gadaleta A, Blanco A. DHPLC technology for high-throughput detection of mutations in a durum wheat TILLING population. BMC Genetics. 2016;17(1):43.
- Randall L, Coldham N, Woodward MJ. Detection of mutations in Salmonella enterica gyrA, gyrB, parC and parE genes by denaturing high performance liquid chromatography (DHPLC) using standard HPLC instrumentation. J Antimicrob Chemother. 2005;56(4):619-23.
|
